Molecular Detection of Epstein Barr Virus Co-Infection in HIV Positive Women Attending Selected Hospitals in Sokoto, Nigeria

Viral infections contribute a larger percentage of all human cancers. Epstein Barr virus (EBV) is type herpes with no clinical manifestation in majority individuals. However, when it occurs adulthood, causes benign lymph proliferative disease known as mononucleosis. This study investigated the molecular detection EBV co-infection among HIV positive women attending some selected hospitals Sokoto, Nigeria. Questionnaires were administered on 80 consenting three Sokoto to gather data socio-demography and risk factors. Blood samples aseptically collected by venipuncture from patients screening done using PCR analysis primer +5' ACAACCACTCATGATGCCAC (Forward), 5' ACCGTGGTTCTGGACTATCT (Reverse) for Type 1 (EBV-1) GGTAGCCTTAGGACATACTC -5' TGGAGGGAGTCCTGTACTAT 2 (EBV-2). Result indicated that (63.75%) age group 21-30 years EBV-1 having highest occurrences 60.7%. Co-infection Nigeria was established prevalence subjects polygamous relationships.