Molecular Detection of Epstein Barr Virus Co-Infection in HIV Positive Women Attending Selected Hospitals in Sokoto, Nigeria

نویسندگان

چکیده

Viral infections contribute a larger percentage of all human cancers. Epstein Barr virus (EBV) is type herpes with no clinical manifestation in majority individuals. However, when it occurs adulthood, causes benign lymph proliferative disease known as mononucleosis. This study investigated the molecular detection EBV co-infection among HIV positive women attending some selected hospitals Sokoto, Nigeria. Questionnaires were administered on 80 consenting three Sokoto to gather data socio-demography and risk factors. Blood samples aseptically collected by venipuncture from patients screening done using PCR analysis primer +5' ACAACCACTCATGATGCCAC (Forward), 5' ACCGTGGTTCTGGACTATCT (Reverse) for Type 1 (EBV-1) GGTAGCCTTAGGACATACTC -5' TGGAGGGAGTCCTGTACTAT 2 (EBV-2). Result indicated that (63.75%) age group 21-30 years EBV-1 having highest occurrences 60.7%. Co-infection Nigeria was established prevalence subjects polygamous relationships.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Molecular Detection of Epstein-Barr virus in Biopsy Samples of Patients Suffering from Bladder Cancer in Bushehr Province, Iran

Background: Bladder cancer is the sixth most common cancer in men and the tenth most common cancer in women. The role of viral infections in the development of urinary bladder cancer has been discussed a lot in recent years. The role of Epstein-Barr Virus (EBV) as a cocarcinogen has been proven in some human cancers. Therefore, the aim of this research is the molecular investigation of EBV in b...

متن کامل

Prevalence of Hepatitis B Virus among Hiv Positive Patients Attending Specialist Hospital Sokoto, Nigeria

Prevalence of hepatitis B virus infection among HIV patients attending Sokoto specialist Hospital, Sokoto state, Nigeria was carried out between June and July, 2012, using Diaspot HbsAg kit (preliminary test) and Biorex Diagnostic ELISA kit (Confirmatory test). Demographic data, clinical characteristics and laboratory results (Questionnaire, CD4 counts and HBsAg) were analyzed. Out of 140 HIV p...

متن کامل

Sero-prevalence of Herpes Simplex and Epstein Barr Viruses in HIV positive patients in Tehran

Abstract Background and Aims: The burden of HIV infection and disease continues to be a major global public health concern all over the world. This study was conducted to measure IgG antibody against EBV viral capsid antigen (EBV-VCA IgG), Herpes Simplex Type1, and 2 to determine the seroprevalence of this infection in HIV-positive population. Materials and Methods: A Cross-sectional st...

متن کامل

Seropidemiology of Epstein – Barr virus infection among asymptomatic

Introduction: Epstein – Barr virus (EBV) is a herpesvirus which establishes a persistent life-long infection in over 95% of adults world wide. Infection is usually asymptomatic but the virus is associated with a variety of disease, including nasopharyngeal carcinoma (NPC), Burkitt’s lymphoma (BL), Multiple sclerosis MS, EBV-associated B-cell lymphoproliferative disease (BLPD), Hodgkin and non...

متن کامل

Distribution of Epstein-Barr Virus and Human Herpesvirus 8 Co-Infections among Human Immunodeficiency Virus -1 Positive Patients

Background and Aims: Among Human Immunodeficiency Virus (HIV)-infected individuals, Epstein-Barr virus (EBV) and Human Herpesvirus (HHV)-8 could cause significant illness as opportunistic infections. The purpose of the present study was to evaluate the prevalence of EBV and HHV-8 in saliva specimens obtained from HIV-1 infected Iranian individuals under the Highly Active Antiviral Therapy (HAAR...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

ژورنال

عنوان ژورنال: Sokoto journal of medical laboratory science

سال: 2023

ISSN: ['2536-7153']

DOI: https://doi.org/10.4314/sokjmls.v7i4.4